Jikky Kij 🐭

@JikkyKjj · Wuhan, China · joined 22 Nov 2021

Lab mouse typing randomly on a keyboard. Some tweets are public interest disclosures #CTCCTCGGCGGGCACGTAG #Modernagate #Jikkyleaks

16 848Followers

1 051Following

10 050Posts total

0Views on collected posts

Latest posts

Oh look.... AGAAGTTATTTGACTCCTGGTGATTCTTCTTCAGGT (RSYLTPGDSSSG) Not found in any virus uploaded before Feb 2020 to GenBank. What a surprise. @Daoyu15 https://t.co/RlfMITNOkD 0 views · 157 likes · 43 reposts · 5 replies 13 Mar 2022 @JikkyKjj This mockery of the procedures has really destroyed my trust in scientific institutions. Anonimous individuals have more integrity and prestige than many overseers. Truly blackpilling. We will have to fight so hard to change this. 0 views · 23 likes · 1 reposts · 1 replies 13 Mar 2022 @JikkyKjj @ydeigin @TyCardon @jeremyphoward @Daoyu15 The alignment in the figure below seems to indicate to me that the homology regions did not result from a recombination event, but rather from a slow accumulation of point mutations in highly variable regions. It would be good 0 views · 5 likes · 1 reposts · 3 replies 13 Mar 2022 I wonder if a newly discovered virus, (let's call it RaTG14) that just "forgot to be uploaded into GenBank" will suddenly be uploaded into GenBank in the next few days, that just happens to contain the genomic sequence for 3 Gp120 inserts that just happen to match #SARSCOV2... 0 views · 256 likes · 65 reposts · 5 replies 13 Mar 2022 @tony_vandongen @ydeigin @TyCardon @jeremyphoward Hi Tony, Before you and Yuri decide they are "natural" even though they have appeared in structurally significant locations "naturally"... Which other virus did the recombination event occur from? Thanks @Daoyu15 0 views · 37 likes · 3 reposts · 2 replies 13 Mar 2022 If you haven't seen the video referenced by Norman Fenton now would be a good time. It shows the level of corruption involved in the universities and the efforts that high profile accounts linked to pharma will go to to shut down dissent. #HillGate 0 views · 211 likes · 91 reposts · 3 replies 13 Mar 2022 Please understand that every study that shows spike toxicity is another warning that you do not want this stuff generated by your own cells. Walter is horrified because he has seen a danger to children that the "virologists" and drug regulators completely missed. 0 views · 440 likes · 196 reposts · 17 replies 13 Mar 2022 This is the tweet that preceded the "Mouse plague" tweet. Not only is #UkrainePete's mouse plague tweet insidious, but this one is too. The wording is interesting. Guess who else said "It was a lousy bioweapon"? https://t.co/sQnoew9TxK 0 views · 213 likes · 67 reposts · 19 replies 13 Mar 2022 WE ARE LIVING IN A HORROR MOVIE. Don't you dare call me a fear mongerer. This is f*ckin' serious. The Spike Protein NOT ONLY DAMAGES THE ENDOTHELIUM, IT ALSO DESTROYS THE CELLS THAT REPAIR IT. W. T. F. W. E. F!!!!!!!!!! STOP THIS, NOW!!!!!!!!!! https://t.co/MRf6tRzE9b http 0 views · 1.7K likes · 765 reposts · 88 replies 12 Mar 2022 1. The story claiming pressure (possibly by Unitaid) to suppress evidence showing Iverm**tin effectiveness against COVID has been very well documented by .@phillyharper (https://t.co/rW42QdOpYu); see also Tess Lawrie's video https://t.co/vcIw6gkKox 0 views · 673 likes · 335 reposts · 20 replies 12 Mar 2022 If you think having a p53-inhibiting protein production factory at the very site of the body most affected by p53-related cancers is "nothing to worry about" you really haven't been paying attention #modernagate #p53gate #spikegate 0 views · 969 likes · 524 reposts · 46 replies 06 Mar 2022 https://t.co/rp7PhJZZOC Toxicity of spike fragments SARS-CoV-2 S protein for zebrafish: A tool to study its hazardous for human health? Zebrafish injected with fragment 16 to 165 (rSpike), presented mortalities and adverse effects on liver, kidney, ovary and brain tissues. 0 views · 287 likes · 153 reposts · 13 replies 06 Feb 2022 @ydeigin @TyCardon @jeremyphoward Yes, they clearly are natural bat virus sequences. Whether their homology with HIV-1 is spurious remains to be seen, since we don't know their function yet ... Maybe the BLAST results was a false positive signal, but it put us on the right pa 0 views · 2 likes · 0 reposts · 2 replies 17 Jan 2022

Similar accounts